Женский Журнал "Остров Любви"

Наслаждайтесь одиночеством! Да, звучит странно, но в одиночестве есть свои преимущества. И поверьте – если вы не научитесь жить сами с собою, вы вряд ли будете счастливы в отношениях. Если вы думаете, что вы являетесь единственным одиноким человеком на этом свете – вы глубоко ошибаетесь. А вот несколько советов, как справиться с одиночеством.

1. Научитесь любить себя!

Каждое утро после того когда вы проснетесь и придете в себя (выпивши достаточное количество кофе) и тем же самым приведете себя в порядок (наложивший достаточный слой макияжа) повторяйте с улыбкой на лице и сияющими глазами «Я самая обаятельная и привлекательная!». Так начав утро вы можете вес день продолжать восхищаться собою, но в меру мы же не хотим, чтобы другие подумали, что мы самовлюбленные.

Выпейте кофе

2. Будьте самоуверенны!

Вы должны верить в себя, прежде чем другие смогут поверить в вас.

Поверьте в себя

3. Не попадайте в депрессию!

Если у вас нету бойфренда – это еще не конец света. Перечислите все те вещи, которые предоставляют вам счастье в жизни и сконцентрируйтесь на них. Да, найти идеального партнера - это прекрасно, но это не единственная вещь, которая может сделать вас счастливыми.

4. Встаньте с дивана!

Да, вы одиноки иногда вам грустно у вас одним словом депресняк – но это не значит, что вы должны сутками сидеть перед ящиком и кушать массовое количество нездоровой пищи. Докажите, что вы выше этого. Найдите себе новое хобби, развлечение, встречайтесь с новыми и старыми друзьями. В конце концов вы встретите интересного человека и если вы будите рассказывать только о том как вы весь год проторчали дома перед телеком – это знакомство наверняка сразу закончиться. Так что – Возьмите себя в руки!

Друзья избавят от одиночества

5. Баловать себя.

Если вы одиноки, живете одни – значит не надо за никем ухаживать и его баловать, правда? Неправда! У вас есть Вы! Избалуйте себя. Сделайте себе приятное, ходите каждую неделю к маникюрщице или парикмахеру, купите билет на концерт, сходите на шоппинг (особенно когда вы сингл, очень важно выглядеть сногсшибательно) или сходите с друзьями в клуб.

6. Выход для стеснительных

Сайт онлайн знакомств

Ну, если вам уже столь тяжело выйти к людям из-за депрессии и вам стыдно показывать всему свету, что вы одиноки и нету обручального кольца - тогда зайдите на сайт знакомств! Объявите всем, что вы свободны и одиноки и вдруг придет вам какое-то письмецо от такого же одинокого человека, который нуждается в вашей поддержке. Нечего терять время и нету смысла упускать возможности, так как «Из всего, что вечно, самый краткий срок у любви».


  • Assubsnaw

    26.01.2023 6:33

    buy clomid tablets online. Another expert, Claudine Isaacs, MD, from the Georgetown Lombardi Comprehensive Cancer Center, in Washington, DC, also considered the new results to be practice changing

  • Assubsnaw

    04.02.2023 4:32

    buy priligy generic Sequences and product lengths for each primer pair were as follow IFT80 Forward 5 AAGGAACCAAAGCATCAAGAATTAG 3; Reverse 5 AGATGTCATCAGGCAGCTTGAC 3; 148 bp; Sox9 Forward 5 TCCCCGCAACAGATCTCCTA 3; Reverse 5 AGGTGGAGTAGAGCCCTGAG 3; 157 bp; Aggrecan Forward 5 CGTTGCAGACCAGGAGCAAT 3; Reverse 5 AGGAGTGACAATGCTGCTCA 3; 145 bp; Type X collagen Forward 5 CGGTACCAAACGCCCACAGGC 3; Reverse 5 GCCTGGCTTCCCCGTGGCTGATAT 3; 258 bp; and GAPDH Forward 5 CACATTGGGGGTAGGAACAC 3; Reverse 5 AACTTTGGCATTGTGGAAGG 3; 222 bp

Оставить комментарий

